AAV-Syn-PSD95.FingR-eGFP-CCR5TC
(Plasmid #125693)

• Purpose: Global labeling of excitatory synapses (green fluorescence)
• Depositing Lab: Xue Han
• Publication: Bensussen et al iScience. 2020 Jun 30;23(7):101330. doi: 10.1016/j.isci.2020.101330.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 4589
• Total vector size (bp): 6238
• Modifications to backbone: Inserted CCR5TC DNA binding sequence upstream of promoter.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PSD95.FingR-eGFP-CCR5TC
• Insert Size (bp): 1596
• Promoter: Synapsin

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGCGGTGGGCAGCGG
• 3′ sequencing primer: CCAGTCAATCTTTCACAAAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Part of this gene was derived from Addgene plasmid 46295 deposited by Don Arnold.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry