AAV-Syn-PSD95.FingR-eGFP-CCR5TC
(Plasmid #125693)

• Purpose: Global labeling of excitatory synapses (green fluorescence)
• Depositing Lab: Xue Han
• Publication: Bensussen et al iScience. 2020 Jun 30;23(7):101330. doi: 10.1016/j.isci.2020.101330.

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 4589
• Total vector size (bp): 6238
• Modifications to backbone: Inserted CCR5TC DNA binding sequence upstream of promoter.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PSD95.FingR-eGFP-CCR5TC
• Insert Size (bp): 1596
• Promoter: Synapsin

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGCGGTGGGCAGCGG
• 3′ sequencing primer: CCAGTCAATCTTTCACAAAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Part of this gene was derived from Addgene plasmid 46295 deposited by Don Arnold.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry