UBQ10:sXVE:S11-GFP1–9
(Plasmid
#125665)
-
PurposeBinary vector for the inducible expression of S11-GFP1–9 fragment that can be used to detect a protein tagged with GFP10
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125665 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUBQ10:sXVE:GFP1–9
-
Backbone manufacturerTzu-Yin Liu
- Total vector size (bp) 15003
-
Vector typePlant Expression, Synthetic Biology
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameS11-GFP1–9
-
SpeciesSynthetic
-
Insert Size (bp)684
- Promoter UBQ10:sXVE:
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer aaggaagttcatttcatttggag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UBQ10:sXVE:S11-GFP1–9 was a gift from Tzu-Yin Liu (Addgene plasmid # 125665 ; http://n2t.net/addgene:125665 ; RRID:Addgene_125665) -
For your References section:
Using Tripartite Split-sfGFP for the Study of Membrane Protein-Protein Interactions. Liu TY. Methods Mol Biol. 2021;2200:323-336. doi: 10.1007/978-1-0716-0880-7_15. 10.1007/978-1-0716-0880-7_15 PubMed 33175385