Skip to main content
Addgene

pKH3
(Plasmid #12555)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12555 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBR322
  • Backbone manufacturer
    none
  • Backbone size (bp) 4750
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • 3xHA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1, BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer CAGGTCCAACTGCACCTCGGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CMV promoter, SV40 ori; BamH1 site in same frame as pGEX-2T; XbaI cloning site is upstream of the triple HA tag, so can add the tag either 5' or 3' to your insert.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKH3 was a gift from Ian Macara (Addgene plasmid # 12555 ; http://n2t.net/addgene:12555 ; RRID:Addgene_12555)
  • For your References section:

    Phosphorylation-dependent activation of the Ras-GRF/CDC25Mm exchange factor by muscarinic receptors and G-protein beta gamma subunits. Mattingly RR, Macara IG. Nature. 1996 Jul 18. 382(6588):268-72. 10.1038/382268a0 PubMed 8717044