Skip to main content
Addgene

lentiSAMv2 rs12189774-guide3
(Plasmid #125498)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125498 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiSAMv2
  • Backbone manufacturer
    Feng Zhang (Addgene #75112)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-VP64-2A-BlastR
  • gRNA/shRNA sequence
    CTAATGGGGGTGGTACCTGA
  • Species
    H. sapiens (human)
  • Promoter EF1a core and U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (destroyed during cloning)
  • 3′ cloning site Unknown (destroyed during cloning)
  • 5′ sequencing primer GATCCGCCACCATGGATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiSAMv2 rs12189774-guide3 was a gift from Jorge Ferrer (Addgene plasmid # 125498 ; http://n2t.net/addgene:125498 ; RRID:Addgene_125498)
  • For your References section:

    Human pancreatic islet three-dimensional chromatin architecture provides insights into the genetics of type 2 diabetes. Miguel-Escalada I, Bonas-Guarch S, Cebola I, Ponsa-Cobas J, Mendieta-Esteban J, Atla G, Javierre BM, Rolando DMY, Farabella I, Morgan CC, Garcia-Hurtado J, Beucher A, Moran I, Pasquali L, Ramos-Rodriguez M, Appel EVR, Linneberg A, Gjesing AP, Witte DR, Pedersen O, Grarup N, Ravassard P, Torrents D, Mercader JM, Piemonti L, Berney T, de Koning EJP, Kerr-Conte J, Pattou F, Fedko IO, Groop L, Prokopenko I, Hansen T, Marti-Renom MA, Fraser P, Ferrer J. Nat Genet. 2019 Jun 28. pii: 10.1038/s41588-019-0457-0. doi: 10.1038/s41588-019-0457-0. 10.1038/s41588-019-0457-0 PubMed 31253982