-
PurposeExpresses wild type 7D12 anti-EGFR nanobodies
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125268 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTrcHis
- Backbone size w/o insert (bp) 4282
- Total vector size (bp) 4702
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name7D12 nanobody
-
Insert Size (bp)4702
- Promoter Trc
-
Tag
/ Fusion Protein
- His-Tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaggtatatattaatgtatcg
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrcHIS-wt7D12 was a gift from Angus Johnston (Addgene plasmid # 125268 ; http://n2t.net/addgene:125268 ; RRID:Addgene_125268) -
For your References section:
Pointing in the Right Direction: Controlling the Orientation of Proteins on Nanoparticles Improves Targeting Efficiency. Yong KW, Yuen D, Chen MZ, Porter CJH, Johnston APR. Nano Lett. 2019 Mar 13;19(3):1827-1831. doi: 10.1021/acs.nanolett.8b04916. Epub 2019 Feb 21. 10.1021/acs.nanolett.8b04916 PubMed 30773887