pCI-syn-fRGECO2
(Plasmid #125244)

• Purpose: Expresses red fluorescent calcium sensor in hippocampal slices
• Depositing Lab: Katalin Torok
• Publication: Kerruth et al J Biol Chem. 2019 Mar 15;294(11):3934-3946. doi: 10.1074/jbc.RA118.004543. Epub 2019 Jan 16.

Backbone

• Vector backbone: pCI
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 3684
• Total vector size (bp): 5097
• Modifications to backbone: CMV promoter replaced by synapsin promoter
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: fRGECO2
• Alt name: jRGECO1a RS-1 EF-4
• Species: R. norvegicus (rat), G. gallus (chicken); Discosoma sp. (Sea anemone)
• Insert Size (bp): 1413
• Mutation: W44Y, D432A
• Promoter: synapsin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: TCCACCATGGTGCAGAACGAGCTTGCTCTTAAG

Resource Information

• Supplemental Documents:
  • pCI-syn-fRGECO2.txt
• A portion of this plasmid was derived from a plasmid made by: Addgene #61563

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

fRGECO2 is the W44Y and D432A variant of the jRGECO1a gene cloned from the pGP-CMV vector (#61563) published by Dana et al. 2016.