Skip to main content
Addgene

pFBOH-MHL.EED
(Plasmid #125174)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125174 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFBOH-MHL baculovirus expression vector
  • Backbone manufacturer
    a gift from the lab of Dr. Yufeng Tong, University of Toronto, Addgene #62304
  • Backbone size w/o insert (bp) 6767
  • Modifications to backbone
    N-terminal His-MBP PreScission cleavage site
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Polycomb protein EED
  • Alt name
    Embryonic ectoderm development protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1326
  • GenBank ID
    8726 8726
  • Entrez Gene
    EED (a.k.a. COGIS, HEED, WAIT1)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • His-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer 5’ sequencing primer pFBOH-fwd 5’ CCGGATTATTCATACCGTCCCACCA 3’
  • 3′ sequencing primer 3’ sequencing primer pFBOH-rev 5’ CTGATTATGATCCTCTAGTACTTCT 3
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFBOH-MHL.EED was a gift from Chen Davidovich (Addgene plasmid # 125174 ; http://n2t.net/addgene:125174 ; RRID:Addgene_125174)
  • For your References section:

    RNA exploits an exposed regulatory site to inhibit the enzymatic activity of PRC2. Zhang Q, McKenzie NJ, Warneford-Thomson R, Gail EH, Flanigan SF, Owen BM, Lauman R, Levina V, Garcia BA, Schittenhelm RB, Bonasio R, Davidovich C. Nat Struct Mol Biol. 2019 Mar;26(3):237-247. doi: 10.1038/s41594-019-0197-y. Epub 2019 Mar 4. 10.1038/s41594-019-0197-y PubMed 30833789