Skip to main content
Addgene

pFBOH-MHL.EZH2
(Plasmid #125171)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125171 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pFBOH-MHL baculovirus expression vector
  • Backbone manufacturer
    a gift from the lab of Dr. Yufeng Tong, University of Toronto, Addgene #62304
  • Backbone size w/o insert (bp) 6767
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EZH2
  • Alt name
    Histone-lysine N-methyltransferase EZH2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2256
  • GenBank ID
    2146
  • Entrez Gene
    EZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • His-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer 5’ sequencing primer pFBOH-fwd 5’ CCGGATTATTCATACCGTCCCACCA 3’
  • 3′ sequencing primer 3’ sequencing primer pFBOH-rev 5’ CTGATTATGATCCTCTAGTACTTCT 3
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFBOH-MHL.EZH2 was a gift from Chen Davidovich (Addgene plasmid # 125171 ; http://n2t.net/addgene:125171 ; RRID:Addgene_125171)

  • For your References section:

    RNA exploits an exposed regulatory site to inhibit the enzymatic activity of PRC2. Zhang Q, McKenzie NJ, Warneford-Thomson R, Gail EH, Flanigan SF, Owen BM, Lauman R, Levina V, Garcia BA, Schittenhelm RB, Bonasio R, Davidovich C. Nat Struct Mol Biol. 2019 Mar;26(3):237-247. doi: 10.1038/s41594-019-0197-y. Epub 2019 Mar 4. 10.1038/s41594-019-0197-y PubMed 30833789
Related items:
Commonly requested with: