Skip to main content
Addgene

pOTTC1761 - pAAV SYN1 DIO HA-hM3D(Gq)
(Plasmid #125147)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125147 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pOTTC901 - pAAV SYN1 DIO GIRK4-Myc
  • Backbone manufacturer
    NIDA_GEVVC
  • Backbone size w/o insert (bp) 4811
  • Total vector size (bp) 6124
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HA-tagged hM3D(Gq)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1800
  • GenBank ID
    1131 CHRM3
  • Entrez Gene
    CHRM3 (a.k.a. EGBRS, HM3, PBS, m3AChR)
  • Promoter SYN1
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer hSYN1 F417 ACTCAGCGCTGCCTCAGTCT
  • 3′ sequencing primer WPRE R1 ATGAAAGCCATACGGGAAGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1761 - pAAV SYN1 DIO HA-hM3D(Gq) was a gift from Christopher Richie (Addgene plasmid # 125147 ; http://n2t.net/addgene:125147 ; RRID:Addgene_125147)
Related items:
Commonly requested with: