pcDNA-FLAG-MYO1D
(Plasmid #125125)

• Purpose: Expresses human FLAG-MYO1D
• Depositing Lab: Bruce Beutler
• Publication: McAlpine et al Dis Model Mech. 2018 Sep 27;11(9). pii: 11/9/dmm035923. doi: 10.1242/dmm.035923.

Backbone

• Vector backbone: pcDNA6
• Backbone size w/o insert (bp): 5090
• Total vector size (bp): 8096
• Modifications to backbone: FLAG
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MYO1D
• Species: H. sapiens (human)
• Insert Size (bp): 3018
• GenBank ID: NM_015194.3
• Entrez Gene: MYO1D (a.k.a. PPP1R108, myr4)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Resource Information

• Supplemental Documents:
  • pcDNA6-FLAG-MYO1D.gb
• A portion of this plasmid was derived from a plasmid made by: Origene

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry