pKmK.C4
(Plasmid #125062)

• Purpose: Storage plasmid for K.marxianus ARS
• Depositing Lab: John Morrissey
• Publication: Rajkumar et al Front Bioeng Biotechnol. 2019 May 7;7:97. doi: 10.3389/fbioe.2019.00097. eCollection 2019.

Backbone

• Vector backbone: YTK001
• Backbone manufacturer: Dueber lab, UC Berkeley
• Backbone size w/o insert (bp): 1667
• Vector type: Yeast Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KmARS2
• Insert Size (bp): 232

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: tttgctggccttttgctc
• 3′ sequencing primer: catctggatttgttcagaacg

Resource Information

• Supplemental Documents:
  • pKmK.C4

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains the appropriate YTK-compatible Golden Gate overhangs for a type 7 part.

Please Note: Some of the bases in the native sequence were modified to eliminate an endogeneous BsaI site that interfered with Golden Gate cloning, but plasmids using the modified ARS have been stable so far in experiments.