pKmK.C3
(Plasmid #125061)

• Purpose: Storage plasmid for K.marxianus centromere
• Depositing Lab: John Morrissey
• Publication: Rajkumar et al Front Bioeng Biotechnol. 2019 May 7;7:97. doi: 10.3389/fbioe.2019.00097. eCollection 2019.

Backbone

• Vector backbone: YTK001
• Backbone manufacturer: Dueber lab, UC Berkeley
• Backbone size w/o insert (bp): 1667
• Vector type: Yeast Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KmARS/CEN6
• Insert Size (bp): 1174

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: tttgctggccttttgctc
• 3′ sequencing primer: catctggatttgttcagaacg

Resource Information

• Supplemental Documents:
  • pKmK.C3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains the appropriate YTK-compatible Golden Gate overhangs for a type 7 part. Equivalent to the ARS2/CEN sequence from strain ATCC 12424

Please note: Addgene NGS finds a mixed population (C/T) at single nucleotide in KmARS/Cen6.