Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKmK.P4
(Plasmid #125037)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125037 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    YTK001
  • Backbone manufacturer
    Dueber lab, UC Berkeley
  • Backbone size w/o insert (bp) 1667
  • Vector type
    Yeast Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TDH1 promoter
  • Alt name
    GAPDH1/GAP1 promoter
  • Insert Size (bp)
    999

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer tttgctggccttttgctc
  • 3′ sequencing primer catctggatttgttcagaacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains the appropriate YTK-compatible Golden Gate overhangs for a type 2 part

Please note: Addgene NGS finds two ambiguous bases within the KmTDH1pr sequence. It is not known if these regions contain regulatory elements.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKmK.P4 was a gift from John Morrissey (Addgene plasmid # 125037 ; http://n2t.net/addgene:125037 ; RRID:Addgene_125037)
  • For your References section:

    Biological Parts for Kluyveromyces marxianus Synthetic Biology. Rajkumar AS, Varela JA, Juergens H, Daran JG, Morrissey JP. Front Bioeng Biotechnol. 2019 May 7;7:97. doi: 10.3389/fbioe.2019.00097. eCollection 2019. 10.3389/fbioe.2019.00097 PubMed 31134195