Skip to main content
Addgene

pKmK.I3L
(Plasmid #125032)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125032 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    YTK001
  • Backbone manufacturer
    Dueber lab, UC Berkeley
  • Backbone size w/o insert (bp) 1667
  • Vector type
    Yeast Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Left homology arm for targeting integration to SWF1/ARO1
  • Insert Size (bp)
    878

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tttgctggccttttgctc
  • 3′ sequencing primer catctggatttgttcagaacg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Meant for the construction of integrative vectors (single- or multi-gene). Contains the appropriate YTK-compatible Golden Gate overhangs for a type 1 part. The necessary internal BsmBI sites to use this as a connector for multi-gene assembly have been added by PCR.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKmK.I3L was a gift from John Morrissey (Addgene plasmid # 125032 ; http://n2t.net/addgene:125032 ; RRID:Addgene_125032)

  • For your References section:

    Biological Parts for Kluyveromyces marxianus Synthetic Biology. Rajkumar AS, Varela JA, Juergens H, Daran JG, Morrissey JP. Front Bioeng Biotechnol. 2019 May 7;7:97. doi: 10.3389/fbioe.2019.00097. eCollection 2019. 10.3389/fbioe.2019.00097 PubMed 31134195
Related items:
Commonly requested with: