pKmK.I2L
(Plasmid #125031)

• Purpose: Storage plasmid for K.marxianus left homology arm; type 1 part
• Depositing Lab: John Morrissey
• Publication: Rajkumar et al Front Bioeng Biotechnol. 2019 May 7;7:97. doi: 10.3389/fbioe.2019.00097. eCollection 2019.

Backbone

• Vector backbone: YTK001
• Backbone manufacturer: Dueber lab, UC Berkeley
• Backbone size w/o insert (bp): 1667
• Vector type: Yeast Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Left homology arm for targeting integration to chromosome V: 23743..21744
• Insert Size (bp): 1029

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tttgctggccttttgctc
• 3′ sequencing primer: catctggatttgttcagaacg

Resource Information

• Supplemental Documents:
  • pKmK.I2L.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Meant for the construction of integrative vectors (single- or multi-gene). Contains the appropriate YTK-compatible Golden Gate overhangs for a type 1 part. The necessary internal BsmBI sites to use this as a connector for multi-gene assembly have been added by PCR.