pAS4.1w-tet-on-NORAD
(Plasmid
#125010)
-
Purposeexpress in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125010 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAS4.1w tet-on
- Backbone size w/o insert (bp) 8491
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHomo sapiens non-coding RNA activated by DNA damage (NORAD), long non-coding RNA
-
Alt nameNORAD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5341
-
GenBank IDNR_027451.1 NR_027451.1
-
Entrez GeneNORAD (a.k.a. LINC00657)
- Promoter TRE-Tight
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site acc65I (unknown if destroyed)
- 3′ cloning site NHE1 (unknown if destroyed)
- 5′ sequencing primer taagcagagctcgtttagtg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAS4.1w-tet-on-NORAD was a gift from Ruey-Hwa Chen (Addgene plasmid # 125010 ; http://n2t.net/addgene:125010 ; RRID:Addgene_125010) -
For your References section:
LncRNA NORAD is repressed by the YAP pathway and suppresses lung and breast cancer metastasis by sequestering S100P. Tan BS, Yang MC, Singh S, Chou YC, Chen HY, Wang MY, Wang YC, Chen RH. Oncogene. 2019 Jul;38(28):5612-5626. doi: 10.1038/s41388-019-0812-8. Epub 2019 Apr 9. 10.1038/s41388-019-0812-8 PubMed 30967631