Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAS4.1w-tet-on-NORAD
(Plasmid #125010)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125010 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAS4.1w tet-on
  • Backbone size w/o insert (bp) 8491
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homo sapiens non-coding RNA activated by DNA damage (NORAD), long non-coding RNA
  • Alt name
    NORAD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5341
  • GenBank ID
    NR_027451.1 NR_027451.1
  • Entrez Gene
    NORAD (a.k.a. LINC00657)
  • Promoter TRE-Tight

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site acc65I (unknown if destroyed)
  • 3′ cloning site NHE1 (unknown if destroyed)
  • 5′ sequencing primer taagcagagctcgtttagtg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAS4.1w-tet-on-NORAD was a gift from Ruey-Hwa Chen (Addgene plasmid # 125010 ; http://n2t.net/addgene:125010 ; RRID:Addgene_125010)
  • For your References section:

    LncRNA NORAD is repressed by the YAP pathway and suppresses lung and breast cancer metastasis by sequestering S100P. Tan BS, Yang MC, Singh S, Chou YC, Chen HY, Wang MY, Wang YC, Chen RH. Oncogene. 2019 Jul;38(28):5612-5626. doi: 10.1038/s41388-019-0812-8. Epub 2019 Apr 9. 10.1038/s41388-019-0812-8 PubMed 30967631