Skip to main content
Addgene

OA-1045B
(Plasmid #125004)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125004 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    attB
  • Backbone size w/o insert (bp) 7473
  • Total vector size (bp) 10715
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eve gRNA
  • gRNA/shRNA sequence
    ATCGTGCGGTGCTGAGAG
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    eve (a.k.a. Dmel_CG2328, 10.5, 10.9, 14.10, 20.35, CG2328, Dm-eve, Dmel\CG2328, E(eve), EVE, Eve, Even, F, V, VI, dm-eve, eve2, even, l(2)46CFg, l(2)46CFh, l(2)46CFj, l(2)46CFp, l(2)46Ce, l(2)46Cg)
  • Promoter U6:3

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aaaaatggtgggcataatagtgttgtt
  • 3′ sequencing primer gGCTTCGAGACCGTGACCTACATC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OA-1045B was a gift from Omar Akbari (Addgene plasmid # 125004 ; http://n2t.net/addgene:125004 ; RRID:Addgene_125004)

  • For your References section:

    Engineered reproductively isolated species drive reversible population replacement. Buchman A, Shriner I, Yang T, Liu J, Antoshechkin I, Marshall JM, Perry MW, Akbari OS. Nat Commun. 2021 Jun 2;12(1):3281. doi: 10.1038/s41467-021-23531-z. 10.1038/s41467-021-23531-z PubMed 34078888
Related items: