pTagGFP2-N SIN1 delta2-29
(Plasmid #124923)

• Purpose: For expression of a.a.2-29 deletion mutant of SIN1-GFP
• Depositing Lab: Jin Chen
• Publication: Hwang et al Cancer Res. 2019 Jul 1;79(13):3178-3184. doi: 10.1158/0008-5472.CAN-18-3658. Epub 2019 May 13.

Backbone

• Vector backbone: pTagGFP2-N
• Backbone manufacturer: Evrogen
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MAPKAP1
• Alt name: SIN1
• Alt name: mSIN1
• Species: H. sapiens (human)
• Mutation: Insert ORF was sirently mutated to be resistent to sgMAPKAP1_1.
• Entrez Gene: MAPKAP1 (a.k.a. JC310, MIP1, SIN1, SIN1b, SIN1g)
• Tag / Fusion Protein:
  • TagGFP2 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CMV Forward
• 3′ sequencing primer: TagGFP-Rev, GCGCACGCTGAACTTGTGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry