pQ2aB
(Plasmid
#124887)
-
Purpose(Empty Backbone) Basic Retroviral backbone with multiple 2a sites, linkers, BFP and and IRES_puromycin from pQCXIP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQCXIP
-
Backbone manufacturerClontech
- Backbone size (bp) 7162
-
Modifications to backboneAdded multiple 2a sites, ser-gly linkers, BFP and cloning sites
-
Vector typeMammalian Expression, Retroviral
- Promoter CMV
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- Blue Flourescent Protein, Flag
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATAGAAGACACCGGGACCGA
- 3′ sequencing primer AGCTCGAGATCTGAGTCCGGAATTAAGCTTGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQ2aB was a gift from Nevil Singh (Addgene plasmid # 124887 ; http://n2t.net/addgene:124887 ; RRID:Addgene_124887)