Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CaMKII-EGFPKASH
(Plasmid #124882)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124882 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CaMKII-EGFP
  • Backbone manufacturer
    Addgene#50469
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFP
  • Promoter CaMKII
  • Tag / Fusion Protein
    • KASH (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer AAGGACGACGGCAACTACAA
  • 3′ sequencing primer CAGAGGTTGATTATCGATAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

bioRxiv pre-print 10.1101/579250

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKII-EGFPKASH was a gift from Vassilis Pachnis (Addgene plasmid # 124882 ; http://n2t.net/addgene:124882 ; RRID:Addgene_124882)
  • For your References section:

    Neuronal programming by microbiota regulates intestinal physiology. Obata Y, Castano A, Boeing S, Bon-Frauches AC, Fung C, Fallesen T, de Aguero MG, Yilmaz B, Lopes R, Huseynova A, Horswell S, Maradana MR, Boesmans W, Vanden Berghe P, Murray AJ, Stockinger B, Macpherson AJ, Pachnis V. Nature. 2020 Feb;578(7794):284-289. doi: 10.1038/s41586-020-1975-8. Epub 2020 Feb 5. 10.1038/s41586-020-1975-8 PubMed 32025031