PyronicSF-mRuby2/pBI-CMV1
(Plasmid #124830)

• Purpose: Highly resposive GFP-based pyruvate nanosensor.
• Depositing Lab: Luis Felipe Barros
• Publication: Arce-Molina et al eLife. 2020 Mar 6;9. pii: 53917. doi: 10.7554/eLife.53917.

Backbone

• Vector backbone: pBI-CMV1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3097
• Total vector size (bp): 5311
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: PyronicSF
• Alt name: Pyruvate Optical Nano-Indicator from CECs Single-Fluorophore
• Species: Synthetic
• Insert Size (bp): 1500
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: SV40-pArev

Gene/Insert 2

• Gene/Insert name: mRuby2
• Species: Synthetic
• Insert Size (bp): 714
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: PstI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: agtgccacctgacgtcggcagt
• 3′ sequencing primer: atcgcctggagaattcaccggt

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/611806v1 for BioRxiv preprint