Skip to main content
Addgene

pcDNA3.1-deltaA1-Lock-VWF
(Plasmid #124824)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124824 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Total vector size (bp) 13437
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VWF without A1 domain and Lock A2 domain
  • Species
    H. sapiens (human)
  • Entrez Gene
    VWF (a.k.a. F8VWF, VWD)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstB1 (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer taggcgtgtacggtgggaggtct
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

I471V mutation in VWF has no impact on function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-deltaA1-Lock-VWF was a gift from Sriram Neelamegham (Addgene plasmid # 124824 ; http://n2t.net/addgene:124824 ; RRID:Addgene_124824)

  • For your References section:

    von Willebrand factor self-association is regulated by the shear-dependent unfolding of the A2 domain. Zhang C, Kelkar A, Neelamegham S. Blood Adv. 2019 Apr 9;3(7):957-968. doi: 10.1182/bloodadvances.2018030122. 10.1182/bloodadvances.2018030122 PubMed 30936056
Related items:
Commonly requested with: