PX459-gR2A_Hinge
(Plasmid
#124811)
-
PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX459
- Backbone size w/o insert (bp) 9174
- Total vector size (bp) 9289
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR
-
Selectable markersPuromycin ; R166H in PuroR (please see depositors comment below)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9 – gRNA_R2A_hinge
-
Alt namePX459-gR2A_hinge
-
SpeciesSynthetic
-
MutationR166H in PuroR (please see depositors comment below)
- Promoter pUC
-
Tags
/ Fusion Proteins
- 3XFLAG (N terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The gRNA is inserted in the PX459 backbone (#48139). The Puro gene in this plasmid has a point mutation that renders it less effective.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX459-gR2A_Hinge was a gift from Ferenc Scheeren & Martijn Verdoes (Addgene plasmid # 124811 ; http://n2t.net/addgene:124811 ; RRID:Addgene_124811) -
For your References section:
Functional diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. van der Schoot JMS, Fennemann FL, Valente M, Dolen Y, Hagemans IM, Becker AMD, Le Gall CM, van Dalen D, Cevirgel A, van Bruggen JAC, Engelfriet M, Caval T, Bentlage AEH, Fransen MF, Nederend M, Leusen JHW, Heck AJR, Vidarsson G, Figdor CG, Verdoes M, Scheeren FA. Sci Adv. 2019 Aug 28;5(8):eaaw1822. doi: 10.1126/sciadv.aaw1822. eCollection 2019 Aug. 10.1126/sciadv.aaw1822 PubMed 31489367