pHybr_r2a>m2a(silent)-srt-his
(Plasmid
#124807)
-
PurposeHDR template to knock-in FC silent mIgG2a isotype in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to FC silent producing cell lines.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHybr_r2a
- Backbone size w/o insert (bp) 4706
- Total vector size (bp) 5797
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR ; HDR template
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMurine IgG2a (Fc silent)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1091
-
MutationL234A/L235A/N297A
-
Tags
/ Fusion Proteins
- Sortag (LPETGG) (C terminal on insert)
- Histag (HHHHHH) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer CACATTGCCAAAAGACGGCA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHybr_r2a>m2a(silent)-srt-his was a gift from Ferenc Scheeren & Martijn Verdoes (Addgene plasmid # 124807 ; http://n2t.net/addgene:124807 ; RRID:Addgene_124807) -
For your References section:
Functional diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. van der Schoot JMS, Fennemann FL, Valente M, Dolen Y, Hagemans IM, Becker AMD, Le Gall CM, van Dalen D, Cevirgel A, van Bruggen JAC, Engelfriet M, Caval T, Bentlage AEH, Fransen MF, Nederend M, Leusen JHW, Heck AJR, Vidarsson G, Figdor CG, Verdoes M, Scheeren FA. Sci Adv. 2019 Aug 28;5(8):eaaw1822. doi: 10.1126/sciadv.aaw1822. eCollection 2019 Aug. 10.1126/sciadv.aaw1822 PubMed 31489367