Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHybr_r2a>m2a(silent)-srt-his
(Plasmid #124807)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124807 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHybr_r2a
  • Backbone size w/o insert (bp) 4706
  • Total vector size (bp) 5797
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR ; HDR template
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Murine IgG2a (Fc silent)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1091
  • Mutation
    L234A/L235A/N297A
  • Tags / Fusion Proteins
    • Sortag (LPETGG) (C terminal on insert)
    • Histag (HHHHHH) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GTAAAACGACGGCCAGT
  • 3′ sequencing primer CACATTGCCAAAAGACGGCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHybr_r2a>m2a(silent)-srt-his was a gift from Ferenc Scheeren & Martijn Verdoes (Addgene plasmid # 124807 ; http://n2t.net/addgene:124807 ; RRID:Addgene_124807)
  • For your References section:

    Functional diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. van der Schoot JMS, Fennemann FL, Valente M, Dolen Y, Hagemans IM, Becker AMD, Le Gall CM, van Dalen D, Cevirgel A, van Bruggen JAC, Engelfriet M, Caval T, Bentlage AEH, Fransen MF, Nederend M, Leusen JHW, Heck AJR, Vidarsson G, Figdor CG, Verdoes M, Scheeren FA. Sci Adv. 2019 Aug 28;5(8):eaaw1822. doi: 10.1126/sciadv.aaw1822. eCollection 2019 Aug. 10.1126/sciadv.aaw1822 PubMed 31489367