pHybr_r2a>mG1-srt-his
(Plasmid #124802)

• Purpose: HDR template to knock-in mouse IgG1 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG1 producing cell lines.
• Depositing Labs: Ferenc Scheeren, Martijn Verdoes
• Publication: van der Schoot et al Sci Adv. 2019 Aug 28;5(8):eaaw1822. doi: 10.1126/sciadv.aaw1822. eCollection 2019 Aug.

Backbone

• Vector backbone: pHybr_r2a
• Backbone size w/o insert (bp): 4706
• Total vector size (bp): 5779
• Vector type: Mammalian Expression, Bacterial Expression, CRISPR ; HDR template
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Murine IgG1
• Species: M. musculus (mouse)
• Insert Size (bp): 1073
• Promoter: -
• Tags / Fusion Proteins:
  • Sortag (LPETGG) (C terminal on insert)
  • Histag (HHHHHH) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GTAAAACGACGGCCAGT
• 3′ sequencing primer: CACATTGCCAAAAGACGGCA

Resource Information

• Supplemental Documents:
  • pHybr_r2a mG1-srt-his.gbk
  • pHybr_r2a mG1-srt-his.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry