pLVX-TetOne-Puro-hAXL
(Plasmid #124797)

• Purpose: Tet-inducible AXL expression in mammalian cells
• Depositing Lab: Kenneth Pienta
• Publication: Axelrod et al Mol Cancer Res. 2019 Feb;17(2):356-369. doi: 10.1158/1541-7786.MCR-18-0718. Epub 2018 Oct 5.

Backbone

• Vector backbone: pLVX-TetOne-Puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 9227
• Total vector size (bp): 11904
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AXL
• Alt name: AXL tyrosine receptor kinase
• Species: H. sapiens (human)
• Insert Size (bp): 2683
• GenBank ID: NM_021913
• Entrez Gene: AXL (a.k.a. ARK, AXL3, JTK11, Tyro7, UFO)
• Promoter: TRE3GS

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: AgeI (unknown if destroyed)
• 5′ sequencing primer: AACGGACGTGAAGAATGTG
• 3′ sequencing primer: GCTTGGCAGCTCAGGTTGAA

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry