pLentiCMVNeoDEST(705-1)-hAXL
(Plasmid #124796)

• Purpose: Expresses AXL in mammalian cells
• Depositing Lab: Kenneth Pienta
• Publication: Axelrod et al Mol Cancer Res. 2019 Feb;17(2):356-369. doi: 10.1158/1541-7786.MCR-18-0718. Epub 2018 Oct 5.

Backbone

• Vector backbone: pLenti CMV Neo DEST (705-1)
• Backbone manufacturer: Addgene 17392 (Eric Campeau & Paul Kaufman)
• Backbone size w/o insert (bp): 9805
• Total vector size (bp): 10838
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Other strains are also appropriate.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AXL
• Alt name: AXL tyrosine receptor kinase
• Species: H. sapiens (human)
• Insert Size (bp): 2683
• GenBank ID: NM_021913
• Entrez Gene: AXL (a.k.a. ARK, AXL3, JTK11, Tyro7, UFO)
• Promoter: CMV

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CMV-forward: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry