Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

nSYB-GAL80-DD
(Plasmid #124778)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124778 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pattB-nsyb
  • Total vector size (bp) 11359
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TMP-inducible destabilized GAL80 (GAL80-DD)
  • Alt name
    GAL80-ecDHFR
  • Species
    D. melanogaster (fly)
  • Promoter nSynaptobrevin
  • Tag / Fusion Protein
    • DD (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site AatII (unknown if destroyed)
  • 5′ sequencing primer SYBFOR5: TGGAAGACAGTGAAAGAGGC
  • 3′ sequencing primer hsp70REV-SEQ:GCAAACTCACTCCCTGACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The nSYB promoter contains several polymorphisms compared to the reference sequence that do not affect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nSYB-GAL80-DD was a gift from Jing-W Wang (Addgene plasmid # 124778 ; http://n2t.net/addgene:124778 ; RRID:Addgene_124778)
  • For your References section:

    A versatile genetic tool for post-translational control of gene expression in Drosophila melanogaster. Sethi S, Wang JW. Elife. 2017 Nov 15;6. pii: e30327. doi: 10.7554/eLife.30327. 10.7554/eLife.30327 PubMed 29140243