nSYB-GAL80-DD
(Plasmid #124778)

• Purpose: Expresses GAL80 fused with destabilizing domain (DD) downstream of a n-Synaptobrevin promoter
• Depositing Lab: Jing-W Wang
• Publication: Sethi et al Elife. 2017 Nov 15;6. pii: e30327. doi: 10.7554/eLife.30327.

Backbone

• Vector backbone: pattB-nsyb
• Total vector size (bp): 11359
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TMP-inducible destabilized GAL80 (GAL80-DD)
• Alt name: GAL80-ecDHFR
• Species: D. melanogaster (fly)
• Promoter: nSynaptobrevin
• Tag / Fusion Protein:
  • DD (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: AatII (unknown if destroyed)
• 5′ sequencing primer: SYBFOR5: TGGAAGACAGTGAAAGAGGC
• 3′ sequencing primer: hsp70REV-SEQ:GCAAACTCACTCCCTGACA

Resource Information

• Supplemental Documents:
  • nsyb-GAL80-DD-hsp70.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The nSYB promoter contains several polymorphisms compared to the reference sequence that do not affect the function of the plasmid.