SL016: AAV-CAG-FLEX-CheRiff-GFP
(Plasmid
#124776)
-
PurposeFor AAV based expression of CheRiff in Cre-Positive cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV-CAG-FLEX
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 6800
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCheRiff-GFP
-
SpeciesSynthetic
-
Insert Size (bp)1700
- Promoter CAG
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaacgtgctggttattgtg
- 3′ sequencing primer tcacaaattttgtaatccag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SL016: AAV-CAG-FLEX-CheRiff-GFP was a gift from Adam Cohen (Addgene plasmid # 124776 ; http://n2t.net/addgene:124776 ; RRID:Addgene_124776) -
For your References section:
Wide-area all-optical neurophysiology in acute brain slices. Farhi SL, Parot VJ, Grama A, Yamagata M, Abdelfattah AS, Adam Y, Lou S, Jun Kim J, Campbell RE, Cox DD, Cohen AE. J Neurosci. 2019 Apr 5. pii: JNEUROSCI.0168-19.2019. doi: 10.1523/JNEUROSCI.0168-19.2019. 10.1523/JNEUROSCI.0168-19.2019 PubMed 30952812
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/124/124776/124776-map_V7NXT5NWlJ0W.pdf.940x940_q85_autocrop.png)