SLF063: Lenti-fCAG-jRGECO1a
(Plasmid
#124775)
-
PurposeFor general lentiviral or direct expression of cytosolic jRGECO1a
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124775 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonefCAG-WPRE
- Backbone size w/o insert (bp) 9800
- Total vector size (bp) 11100
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namejRGECO1a
-
SpeciesSynthetic
-
Insert Size (bp)1300
- Promoter CAG
-
Tag
/ Fusion Protein
- NES-6xHIS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaacgtgctggttattgtg
- 3′ sequencing primer CAAAGGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SLF063: Lenti-fCAG-jRGECO1a was a gift from Adam Cohen (Addgene plasmid # 124775 ; http://n2t.net/addgene:124775 ; RRID:Addgene_124775) -
For your References section:
Wide-area all-optical neurophysiology in acute brain slices. Farhi SL, Parot VJ, Grama A, Yamagata M, Abdelfattah AS, Adam Y, Lou S, Jun Kim J, Campbell RE, Cox DD, Cohen AE. J Neurosci. 2019 Apr 5. pii: JNEUROSCI.0168-19.2019. doi: 10.1523/JNEUROSCI.0168-19.2019. 10.1523/JNEUROSCI.0168-19.2019 PubMed 30952812
Map uploaded by the depositor.
