MS2_adRNA-MCP_ADAR2 DD_NES
(Plasmid
#124706)
-
PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with the MCP_ADAR2 DD_NES
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUnknown
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMCP_ADAR2 DD_NES
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1626
-
Entrez GeneRAB7A (a.k.a. CMT2B, PRO2706, RAB7)
- Promoter CMV
-
Tag
/ Fusion Protein
- NES (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer TCCTTCCGTGTTTCAGTTAGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also expresses MS2_adRNA targeting the RAB7A transcript
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MS2_adRNA-MCP_ADAR2 DD_NES was a gift from Prashant Mali (Addgene plasmid # 124706 ; http://n2t.net/addgene:124706 ; RRID:Addgene_124706) -
For your References section:
In vivo RNA editing of point mutations via RNA-guided adenosine deaminases. Katrekar D, Chen G, Meluzzi D, Ganesh A, Worlikar A, Shih YR, Varghese S, Mali P. Nat Methods. 2019 Mar;16(3):239-242. doi: 10.1038/s41592-019-0323-0. Epub 2019 Feb 8. 10.1038/s41592-019-0323-0 PubMed 30737497