-
Purpose(Empty Backbone) Expresses Flag-miniTurbo fusion for proximity labeling
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCD-betaG-FLAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameminiTurbo
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A miniTurbo cDNA was amplified by PCR from V5-miniTurboID-NES_pcDNA3 (Plamid #107170).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-miniTurbo was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 124647 ; http://n2t.net/addgene:124647 ; RRID:Addgene_124647)