-
Purpose(Empty Backbone) Expresses Flag-TurboID fusion for proximity labeling
-
Depositing Labs
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124646 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCD-betaG-FLAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTurboID
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A TurboID cDNA was amplified by PCR from V5-TurboID-NES_pcDNA3 (Plamid #107169).
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-TurboID was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 124646 ; http://n2t.net/addgene:124646 ; RRID:Addgene_124646)
Ready-to-use antibodies
Looking for antibodies related to this plasmid? Check out these options:
Learn MoreCommonly requested with:
Map uploaded by the depositor.
