Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pShuttle CMV RGECO-TnT
(Plasmid #124643)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124643 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pShuttle CMV
  • Backbone manufacturer
    Agilent
  • Backbone size w/o insert (bp) 7500
  • Total vector size (bp) 9624
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RGECO-TnT
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2124
  • Entrez Gene
    TNNT2 (a.k.a. CMD1D, CMH2, CMPD2, LVNC6, RCM3, TnTC, cTnT)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site not1 (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGTCTATATAAGCAGAGCTG
  • 3′ sequencing primer CTGATCATAATCAGCCATACCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pShuttle CMV RGECO-TnT was a gift from Matthew Daniels & Paul Robinson & Hugh Watkins (Addgene plasmid # 124643 ; http://n2t.net/addgene:124643 ; RRID:Addgene_124643)
  • For your References section:

    Measurement of Myofilament-Localised Calcium Dynamics in Adult Cardiomyocytes and the Effect of Hypertrophic Cardiomyopathy Mutations. Sparrow AJ, Sievert K, Patel S, Chang YF, Broyles CN, Brook FA, Watkins H, Geeves MA, Redwood CS, Robinson P, Daniels MJ. Circ Res. 2019 Feb 8. doi: 10.1161/CIRCRESAHA.118.314600. 10.1161/CIRCRESAHA.118.314600 PubMed 30732532