MS2_adRNA
(Plasmid
#124624)
-
PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUnknown
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2_adRNA_RAB7A
-
gRNA/shRNA sequenceGGGAAATCCAGCTGGCGGCA
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MS2_adRNA was a gift from Prashant Mali (Addgene plasmid # 124624 ; http://n2t.net/addgene:124624 ; RRID:Addgene_124624) -
For your References section:
In vivo RNA editing of point mutations via RNA-guided adenosine deaminases. Katrekar D, Chen G, Meluzzi D, Ganesh A, Worlikar A, Shih YR, Varghese S, Mali P. Nat Methods. 2019 Mar;16(3):239-242. doi: 10.1038/s41592-019-0323-0. Epub 2019 Feb 8. 10.1038/s41592-019-0323-0 PubMed 30737497