Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GluR2_adRNA_(1,20,6)-GFP
(Plasmid #124619)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124619 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Unknown
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GluR2_adRNA(1,20,6)
  • gRNA/shRNA sequence
    GGGAAATCCAGCTGGCGGCA
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A second copy of the GluR2_adRNA_(1,20,6) is expressed from a mouse U6 promoter

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GluR2_adRNA_(1,20,6)-GFP was a gift from Prashant Mali (Addgene plasmid # 124619 ; http://n2t.net/addgene:124619 ; RRID:Addgene_124619)
  • For your References section:

    In vivo RNA editing of point mutations via RNA-guided adenosine deaminases. Katrekar D, Chen G, Meluzzi D, Ganesh A, Worlikar A, Shih YR, Varghese S, Mali P. Nat Methods. 2019 Mar;16(3):239-242. doi: 10.1038/s41592-019-0323-0. Epub 2019 Feb 8. 10.1038/s41592-019-0323-0 PubMed 30737497