pX330-NL-DHFR-SpCas9
(Plasmid #124522)

• Purpose: Expresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cells
• Depositing Lab: Amit Choudhary
• Publication: Manna et al Angew Chem Int Ed Engl. 2019 May 6;58(19):6285-6289. doi: 10.1002/anie.201900788. Epub 2019 Apr 2.

Backbone

• Vector backbone: pX330
• Backbone manufacturer: Feng Zhang
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 9976
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NL-DHFR-SpCas9
• Species: S. pyogenes
• Insert Size (bp): 5199
• Promoter: Cbh
• Tags / Fusion Proteins:
  • Destabilized domain of E.coli dihydrofolate reductase (N terminal on insert)
  • Destabilized domain of E.coli dihydrofolate reductase (internal loop at amino acid 231)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cacctgcctgaaatcactttt
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pX330-NL-DHFR-SpCas9.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry