POLR2A-N CRISPR pX330
(Plasmid
#124495)
-
PurposeA CRISPR plasmid for targeting the N-terminus coding region of human POLR2A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
- Total vector size (bp) 8509
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePOLR2A targeting CRISPR
-
Alt nameRPB1; RPO2; POLR2; POLRA; RPBh1; RPOL2; RpIILS; hsRPB1; hRPB220
-
gRNA/shRNA sequenceGCCACCCCCGTGCATGGCGG
-
SpeciesH. sapiens (human)
- Promoter U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer aggctgttagagagataattgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Addgene NGS is unable to fully resolve the CAG promoter sequence. Please refer to the depositor's sequence for this section of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
POLR2A-N CRISPR pX330 was a gift from Masato Kanemaki (Addgene plasmid # 124495 ; http://n2t.net/addgene:124495 ; RRID:Addgene_124495) -
For your References section:
Single nucleosome imaging reveals loose genome chromatin networks via active RNA polymerase II. Nagashima R, Hibino K, Ashwin SS, Babokhov M, Fujishiro S, Imai R, Nozaki T, Tamura S, Tani T, Kimura H, Shribak M, Kanemaki MT, Sasai M, Maeshima K. J Cell Biol. 2019 Mar 1. pii: jcb.201811090. doi: 10.1083/jcb.201811090. 10.1083/jcb.201811090 PubMed 30824489