Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

POLR2A-N CRISPR pX330
(Plasmid #124495)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124495 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330
  • Total vector size (bp) 8509
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POLR2A targeting CRISPR
  • Alt name
    RPB1; RPO2; POLR2; POLRA; RPBh1; RPOL2; RpIILS; hsRPB1; hRPB220
  • gRNA/shRNA sequence
    GCCACCCCCGTGCATGGCGG
  • Species
    H. sapiens (human)
  • Promoter U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer aggctgttagagagataattgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Addgene NGS is unable to fully resolve the CAG promoter sequence. Please refer to the depositor's sequence for this section of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    POLR2A-N CRISPR pX330 was a gift from Masato Kanemaki (Addgene plasmid # 124495 ; http://n2t.net/addgene:124495 ; RRID:Addgene_124495)
  • For your References section:

    Single nucleosome imaging reveals loose genome chromatin networks via active RNA polymerase II. Nagashima R, Hibino K, Ashwin SS, Babokhov M, Fujishiro S, Imai R, Nozaki T, Tamura S, Tani T, Kimura H, Shribak M, Kanemaki MT, Sasai M, Maeshima K. J Cell Biol. 2019 Mar 1. pii: jcb.201811090. doi: 10.1083/jcb.201811090. 10.1083/jcb.201811090 PubMed 30824489