Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSPgRNA_BLK_E2-1
(Plasmid #124474)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124474 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSPgRNA (Addgene #47108)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BLK_E2-1_gRNA
  • Alt name
    BLK_LA32
  • gRNA/shRNA sequence
    CCACTGAAGAAGGCGAGGCG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    BLK (a.k.a. MODY11)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer hU6-F
  • 3′ sequencing primer T3
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSPgRNA_BLK_E2-1 was a gift from Iouri Chepelev (Addgene plasmid # 124474 ; http://n2t.net/addgene:124474 ; RRID:Addgene_124474)
  • For your References section:

    Haplotype-specific chromatin looping reveals genetic interactions of regulatory regions modulating gene expression in 8p23.1. Saint Just Ribeiro M, Tripathi P, Namjou B, Harley JB, Chepelev I. Front Genet. 2022 Sep 7;13:1008582. doi: 10.3389/fgene.2022.1008582. eCollection 2022. 10.3389/fgene.2022.1008582 PubMed 36160011