Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJET1.2_Rab28_Anti-Sense
(Plasmid #124442)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124442 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJET1.2/blunt
  • Backbone manufacturer
    Thermo Scientific (CloneJET PCR Cloning Kit)
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 3759
  • Vector type
    In situ probe

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RAB28, member RAS oncogene family
  • Alt name
    Rab28
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    785
  • Entrez Gene
    Rab28 (a.k.a. 2700023P08Rik, AW496496)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET1.2_Rab28_Anti-Sense was a gift from Yingguang Frank Chan (Addgene plasmid # 124442 ; http://n2t.net/addgene:124442 ; RRID:Addgene_124442)
  • For your References section:

    An integrative genomic analysis of the Longshanks selection experiment for longer limbs in mice. Castro JP, Yancoskie MN, Marchini M, Belohlavy S, Hiramatsu L, Kucka M, Beluch WH, Naumann R, Skuplik I, Cobb J, Barton NH, Rolian C, Chan YF. Elife. 2019 Jun 6;8:e42014. doi: 10.7554/eLife.42014. 10.7554/eLife.42014 PubMed 31169497