Skip to main content
Addgene

pJET1.2_Gli3_Anti-Sense
(Plasmid #124440)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124440 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJET1.2/blunt
  • Backbone manufacturer
    Thermo Scientific (CloneJET PCR Cloning Kit)
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 3613
  • Vector type
    In situ probe

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GLI-Kruppel family member GLI3
  • Alt name
    Gli3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    639
  • Entrez Gene
    Gli3 (a.k.a. Bph, GLI3-190, GLI3FL, Pdn, Xt, add)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET1.2_Gli3_Anti-Sense was a gift from Yingguang Frank Chan (Addgene plasmid # 124440 ; http://n2t.net/addgene:124440 ; RRID:Addgene_124440)
  • For your References section:

    An integrative genomic analysis of the Longshanks selection experiment for longer limbs in mice. Castro JP, Yancoskie MN, Marchini M, Belohlavy S, Hiramatsu L, Kucka M, Beluch WH, Naumann R, Skuplik I, Cobb J, Barton NH, Rolian C, Chan YF. Elife. 2019 Jun 6;8:e42014. doi: 10.7554/eLife.42014. 10.7554/eLife.42014 PubMed 31169497