pLG163
(Plasmid
#124365)
-
PurposeIPTG inducible system (gfpmut2 with Ppsank) for expression in B. subtilis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJAB186
- Backbone size w/o insert (bp) 7880
- Total vector size (bp) 8591
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegfpmut2
-
SpeciesSynthetic
-
Entrez GeneNEWENTRY
- Promoter Pspank
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer caaatccgccgctctagctaag
- 3′ sequencing primer ttcagcacgtgtcttgtagttccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note this plasmid contains an IS4 transposable element that does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLG163 was a gift from Christopher Voigt (Addgene plasmid # 124365 ; http://n2t.net/addgene:124365 ; RRID:Addgene_124365) -
For your References section:
Resilient living materials built by printing bacterial spores. Gonzalez LM, Mukhitov N, Voigt CA. Nat Chem Biol. 2019 Dec 2. pii: 10.1038/s41589-019-0412-5. doi: 10.1038/s41589-019-0412-5. 10.1038/s41589-019-0412-5 PubMed 31792444