-
PurposeExpresses ER specific HaloTag protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6385
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHalo tag
-
SpeciesH. sapiens (human)
-
Insert Size (bp)957
-
GenBank IDJF920305.1
- Promoter CMV
-
Tag
/ Fusion Protein
- KDEL Seq (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site NOTI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATGGTCATAGCTGTTTCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-KDEL was a gift from Jin Wang (Addgene plasmid # 124316 ; http://n2t.net/addgene:124316 ; RRID:Addgene_124316) -
For your References section:
Quantitative Real-Time Imaging of Glutathione with Sub-Cellular Resolution. Jiang X, Zhang C, Chen J, Choi S, Zhou Y, Zhao M, Song X, Chen X, Maletic-Savatic M, Palzkill TG, Moore D, Wang MC, Wang J. Antioxid Redox Signal. 2018 Oct 25. doi: 10.1089/ars.2018.7605. 10.1089/ars.2018.7605 PubMed 30358421