Skip to main content
Addgene

Halo-KDEL
(Plasmid #124316)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124316 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 6385
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Halo tag
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    957
  • GenBank ID
    JF920305.1
  • Promoter CMV
  • Tag / Fusion Protein
    • KDEL Seq (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site NOTI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATGGTCATAGCTGTTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Halo-KDEL was a gift from Jin Wang (Addgene plasmid # 124316 ; http://n2t.net/addgene:124316 ; RRID:Addgene_124316)
  • For your References section:

    Quantitative Real-Time Imaging of Glutathione with Sub-Cellular Resolution. Jiang X, Zhang C, Chen J, Choi S, Zhou Y, Zhao M, Song X, Chen X, Maletic-Savatic M, Palzkill TG, Moore D, Wang MC, Wang J. Antioxid Redox Signal. 2018 Oct 25. doi: 10.1089/ars.2018.7605. 10.1089/ars.2018.7605 PubMed 30358421