Halo-MTS
(Plasmid #124315)

• Purpose: Expresses mitochondria specific HaloTag protein
• Depositing Lab: Jin Wang
• Publication: Jiang et al Antioxid Redox Signal. 2018 Oct 25. doi: 10.1089/ars.2018.7605.

Backbone

• Vector backbone: pcDNA3.1(+)
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6590
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Halo tag
• Species: H. sapiens (human)
• Insert Size (bp): 1162
• GenBank ID: JF920305.1
• Promoter: CMV
• Tag / Fusion Protein:
  • Mito specific seq (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CATGGTCATAGCTGTTTCC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry