NFATc4-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
(Plasmid
#124289)
-
PurposesgRNA against human NFATc4
-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124289 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 62988)
- Backbone size w/o insert (bp) 9200
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNFATc4 nuclear factor of activated T cells
-
Alt nameNFATc4
-
Alt nameNFAT3
-
gRNA/shRNA sequence(g)ATGGCGCTGCACCTATCGGT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)21
-
Entrez GeneNFATC4 (a.k.a. NF-AT3, NF-ATC4, NFAT3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6-fw: GGGCCTATTTCCCATGATTCCTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plus "G" was routinely added because U6 promoter prefers "G" as the first transcribed nucleotide. gRNA sequence contains at least 3 mismatches, and was selected by choosing the highest scored sequence from different programs and databases.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NFATc4-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0) was a gift from Katalin Josvay & Csaba Vizler (Addgene plasmid # 124289 ; http://n2t.net/addgene:124289 ; RRID:Addgene_124289)