Skip to main content
Addgene

pT2-shATRX
(Plasmid #124258)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124258 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pT2
  • Backbone size w/o insert (bp) 6491
  • Total vector size (bp) 6601
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shATRX
  • gRNA/shRNA sequence
    TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCCGCTTGGATGGTTCTACTAATAGTGAAGCCACAGATGTATTAGTAGAACCATCCAAGCGGTTGCCTACTGCCTCGG
  • Species
    M. musculus (mouse)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    John Ohlfest

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT2-shATRX was a gift from Maria Castro (Addgene plasmid # 124258 ; http://n2t.net/addgene:124258 ; RRID:Addgene_124258)

  • For your References section:

    IDH1-R132H acts as a tumor suppressor in glioma via epigenetic up-regulation of the DNA damage response. Nunez FJ, Mendez FM, Kadiyala P, Alghamri MS, Savelieff MG, Garcia-Fabiani MB, Haase S, Koschmann C, Calinescu AA, Kamran N, Saxena M, Patel R, Carney S, Guo MZ, Edwards M, Ljungman M, Qin T, Sartor MA, Tagett R, Venneti S, Brosnan-Cashman J, Meeker A, Gorbunova V, Zhao L, Kremer DM, Zhang L, Lyssiotis CA, Jones L, Herting CJ, Ross JL, Hambardzumyan D, Hervey-Jumper S, Figueroa ME, Lowenstein PR, Castro MG. Sci Transl Med. 2019 Feb 13;11(479). pii: 11/479/eaaq1427. doi: 10.1126/scitranslmed.aaq1427. 10.1126/scitranslmed.aaq1427 PubMed 30760578
Related items:
Commonly requested with: