Skip to main content
Addgene

pJV137
(Plasmid #124256)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124256 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRLsin
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    T cell receptor
  • Species
    H. sapiens (human)
  • Entrez Gene
    ERBB2 (a.k.a. CD340, HER-2, HER-2/neu, HER2, MLN 19, MLN-19, NEU, NGL, TKR1, VSCN2, c-ERB-2, c-ERB2, p185(erbB2))
  • Promoter MSCV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcgcttctgttcgcgcgctt
  • 3′ sequencing primer AACAGGCACACGCTCTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJV137 was a gift from Stanley Riddell (Addgene plasmid # 124256 ; http://n2t.net/addgene:124256 ; RRID:Addgene_124256)
  • For your References section:

    Endogenous CD4(+) T Cells Recognize Neoantigens in Lung Cancer Patients, Including Recurrent Oncogenic KRAS and ERBB2 (Her2) Driver Mutations. Veatch JR, Jesernig BL, Kargl J, Fitzgibbon M, Lee SM, Baik C, Martins R, Houghton AM, Riddell SR. Cancer Immunol Res. 2019 Jun;7(6):910-922. doi: 10.1158/2326-6066.CIR-18-0402. Epub 2019 May 1. 10.1158/2326-6066.CIR-18-0402 PubMed 31043415