Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAT-9251
(Plasmid #124226)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124226 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p15A
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SpCas9-HF1
  • Species
    E. coli
  • Promoter TetR/TetA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGACCTCATTAAGCAGCTCT
  • 3′ sequencing primer GAGGAAGCGGAATATATCCCTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAT-9251 was a gift from Ervin Welker (Addgene plasmid # 124226 ; http://n2t.net/addgene:124226 ; RRID:Addgene_124226)
  • For your References section:

    A method for characterizing Cas9 variants via a one-million target sequence library of self-targeting sgRNAs. Talas A, Huszar K, Kulcsar PI, Varga JK, Varga E, Toth E, Welker Z, Erdos G, Pach PF, Welker A, Gyorgypal Z, Tusnady GE, Welker E. Nucleic Acids Res. 2021 Jan 15. pii: 6101605. doi: 10.1093/nar/gkaa1220. 10.1093/nar/gkaa1220 PubMed 33450024